sample1000101.txt
Moderator: Moderators
Re: sample1000101.txt
Aren't these sequences of 10-digits letters smiliar to the ones found in the video?
Re: sample1000101.txt
Like the wiki says, the centimorgan calculation helps with figuring out how often a gene is passed/changed as a cell divides.
In this case, since we're working with the mitochondrial DNA, they're really getting at whole organism evolution. This is the kinda stuff they do to say all humans came out of a special bunch in Africa or Australia or whatever it is, or to say that everyone is linked to Genghis Khan.
Check out:
http://en.wikipedia.org/wiki/Mitochondr ... ic_studies
Umm, okay. Let me play with it some more.
In this case, since we're working with the mitochondrial DNA, they're really getting at whole organism evolution. This is the kinda stuff they do to say all humans came out of a special bunch in Africa or Australia or whatever it is, or to say that everyone is linked to Genghis Khan.
Check out:
http://en.wikipedia.org/wiki/Mitochondr ... ic_studies
Umm, okay. Let me play with it some more.
- Ibeechu
- Moderator [Designated]
- Posts: 394
- Joined: Wed Jun 13, 2007 10:27 pm
- Location: Jackson, MI
- Contact:
Re: sample1000101.txt
Yes, but the ones in the video might not mean anything. Treading into meta for a moment, but I doubt Bungie would make us learn about all 500-something amino acids in the Sample1000101.txt, and probably would'nt expect us to find out about any amino acids that *could* be hidden in this video. It would simply take WAY too much time and thought if that's what we were supposed to do.Ceantari wrote:Aren't these sequences of 10-digits letters smiliar to the ones found in the video?
-
- Data [Authenticated]
- Posts: 141
- Joined: Mon Jun 18, 2007 5:16 am
- Contact:
Re: sample1000101.txt
well if theres another week gap, i think someone will end up doing it
Re: sample1000101.txt
wait a second wanst there a speculation a couple of weeks back that the flood had something to do with amino acids?
(i cant belive i missed all the excitement of server 4, damn laptop just got shipped back to best buy today /cry)
(i cant belive i missed all the excitement of server 4, damn laptop just got shipped back to best buy today /cry)
Re: sample1000101.txt
Yeah, there are a handful of differences between the sample and the alligator genome in the NCBI database.
http://www.ncbi.nlm.nih.gov/sites/entre ... arch=16824
There are exactly 32 points where the sequences differ.
Normally this wouldn't be that odd, but almost all of them are in areas coding for genes.
Sample: TGGCAATTTGTTTTGAATAGGGGTTTTATCCC
Alligator: AAATCCAAATAACCTCTATACAAACCAGCATA
If you pull out the differences from the amino acid codes, this is what you would get.
Sample: LGNKLF-WL-G-FASCI-SPQ
Alligator: --TNHYKLKQCSLTTWTKGLK
Since this is mitochondrial DNA, these are some relatively important proteins/RNAs that they're screwing with. Also, since this is mitochondrial DNA, remember that the DNA to amino acid transition isn't exactly the same as for regular DNA. If you change it from DNA to protein, these are the differences that pop out. The (-) represents a stop codon.
You could translate the difference sections into one-letter amino acid codes as:
Sample: WQFVLN-GFI
Alligator: KSK-PLYKPA
There’s a bunch more you could do to take this further, but yeah, at first glance I’m not seeing anything that jumps out.
http://www.ncbi.nlm.nih.gov/sites/entre ... arch=16824
There are exactly 32 points where the sequences differ.
Normally this wouldn't be that odd, but almost all of them are in areas coding for genes.
Sample: TGGCAATTTGTTTTGAATAGGGGTTTTATCCC
Alligator: AAATCCAAATAACCTCTATACAAACCAGCATA
If you pull out the differences from the amino acid codes, this is what you would get.
Sample: LGNKLF-WL-G-FASCI-SPQ
Alligator: --TNHYKLKQCSLTTWTKGLK
Since this is mitochondrial DNA, these are some relatively important proteins/RNAs that they're screwing with. Also, since this is mitochondrial DNA, remember that the DNA to amino acid transition isn't exactly the same as for regular DNA. If you change it from DNA to protein, these are the differences that pop out. The (-) represents a stop codon.
You could translate the difference sections into one-letter amino acid codes as:
Sample: WQFVLN-GFI
Alligator: KSK-PLYKPA
There’s a bunch more you could do to take this further, but yeah, at first glance I’m not seeing anything that jumps out.
Re: sample1000101.txt
read through a bunch of info and no one pointed this out yet. the numbers on the page start at 1 and increase +60 every break. between every number is 60 characters. character counter?
-squirrel-
-squirrel-
Re: sample1000101.txt
DocOctavius wrote:Here's a good resource on the flood:
http://nikon.bungie.org/misc/jman571_flood_taxonomy/
Not sure if anything would help this game, but there's more info on the flood if anyone is curious.
But why a Chinese Alligator?
-
- Data [Conditional]
- Posts: 39
- Joined: Thu Jun 14, 2007 3:05 am
Re: sample1000101.txt
OMG! The Forerunners were actually Chinese Alligators!Ceantari wrote:DocOctavius wrote:Here's a good resource on the flood:
http://nikon.bungie.org/misc/jman571_flood_taxonomy/
Not sure if anything would help this game, but there's more info on the flood if anyone is curious.
But why a Chinese Alligator?
-
- Data [Authenticated]
- Posts: 221
- Joined: Mon Jun 25, 2007 12:59 pm
- Location: KW, Ontario
- Contact:
Re: sample1000101.txt
It's the nucleotide count. There are 6 sets of 10 on each line. Quick reference to look up a specific sequence or positionSquirrel wrote:read through a bunch of info and no one pointed this out yet. the numbers on the page start at 1 and increase +60 every break. between every number is 60 characters. character counter?