Page 3 of 8
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 2:31 am
by nicrotross
What if the ark, in a crazy theory, was also a massive DNA library, where the forerunners kept information about every species and creature in existence so that worlds could be re-inhabited after the halos release total hell. Kind of like a Titan AE idea.
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 2:32 am
by theteal1
nicrotross wrote:What if the ark, in a crazy theory, was also a massive DNA library, where the forerunners kept information about every species and creature in existence so that worlds could be re-inhabited after the halos release total hell. Kind of like a Titan AE idea.
I thought that's what the
Libraries on the Halo's were...
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 2:33 am
by nicrotross
If thats true, then that theory might be plausible
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 2:41 am
by ii otnemem ii
nicrotross wrote:What if the ark, in a crazy theory, was also a massive DNA library, where the forerunners kept information about every species and creature in existence so that worlds could be re-inhabited after the halos release total hell. Kind of like a Titan AE idea.
... Planet
Bob. Sweet.
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 3:46 am
by Squirrel
Did some thinking...
The volman book led us to the fact that he was doing research on what is known as "the missing link" or how we as humans became what we are... (i dont like bungie getting all existential on us)
Now the file in quesetion on server 4 is basically a genome of a chinese alligator with the first 15 nucelotides added... where that goes i dont know and i think its our next clue... but i assume that bungie used it as a way of confirming this.
Now run with me here...
::forerunners speaking::
You need look no closer than yourself. (here is where it starts)
The legends that spring up around unaccountable signs, (impossible to account for)
The tiniest differences that make the world habitable, (First reference to DNA)
That's how you came to be known
Thats our connection. (DNA)
That's why I lead you to the renowned (Widely known? have no idea what they are talking of)
Haven't you seen the signs, redeemer?
The small, under-the-surface bridges between all this? (DNA! bridges... youll see where im going)
Those connections saved you before, (key word connections)
But this time, you are on your own.
We are all on our own.
The last two lines are self explanatory... however i interpreted this as we are directly related to the forerunners... like ancestors. That is why they saved our race the first time, because we have slight differences in DNA from them (and that makes us kin j/k) But i also believe that the forerunners also moddified our DNA to inhibit certain qualities of themselves, thus accelerating progression of mankind and civilization as we know it. (whew)
Now as said before the first 15 added nuceotides are a clue, i believe, but i have no idea where to start with it. that being said all i think this clue is going to do is lead us to the bounce of 206.16.223.76 which we found early. any thoughts?
-squirrel-
:://existentialist rant::
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 4:48 am
by beelzebub
Squirrel wrote:read through a bunch of info and no one pointed this out yet. the numbers on the page start at 1 and increase +60 every break. between every number is 60 characters. character counter?
-squirrel-
This is the standard way genomes are presented. Blocks of ten, 60 characters per line. Nothing unusual to see here, and therefore nothing hidden.
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 5:10 am
by beelzebub
Yawar wrote:Yeah, there are a handful of differences between the sample and the alligator genome in the NCBI database.
http://www.ncbi.nlm.nih.gov/sites/entre ... arch=16824
There are exactly 32 points where the sequences differ.
Normally this wouldn't be that odd, but almost all of them are in areas coding for genes.
Sample: TGGCAATTTGTTTTGAATAGGGGTTTTATCCC
Alligator: AAATCCAAATAACCTCTATACAAACCAGCATA
Uh, or isn't it much more likely that the person who first found this particular Alligator mitochondrion sequence happened to match it against a different sample, not the one that the gamemakers used to build sample10000101.txt? Then these differences mean nothing. Were the gamemakers really counting on us identifying the exact sequence they used to build the puzzle, even though we only have a version with mismatches, and then compare the two and produce something meaningful? That seems most dubious. I attribute this to the original being "Close, but no cigar" - e.g., this sample sequence is, say, from some other Alligator, and we haven't found it yet.
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 5:24 am
by beelzebub
Squirrel wrote:Did some thinking...
The volman book led us to the fact that he was doing research on what is known as "the missing link" or how we as humans became what we are... (i dont like bungie getting all existential on us)
Wait - a game where the entire galaxy is being threatened with annihilation and the human race destroyed isn't existential already? The youth of today are so jaded.
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 5:08 pm
by VectorScalar
Going from thebruce's post, I checked
other translations from 35 char. binary string: 01111010100010101001011011010110101 found in the .txt. I input it at
http://www.paulschou.com/tools/xlate/. I simply did a cut-n-paste from notepad, no reformatting. Here are the findings:
Text: zŠ–Ö
base64: eoqW1gU=
dec/char: 122 138 150 214 5
hex: 7a 8a 96 d6 05
The base64 translation looks suspiciously like a bouncepath! I'm not sure why I got something different than thebruce. I also translated 1000101 from the name of the .txt, and got:
Text: E
base64: RQ==
dec/char: 69
hex: 45
Hope this helps, and sorry if old.
Re: sample1000101.txt
Posted: Fri Aug 10, 2007 5:20 pm
by beelzebub
beelzebub wrote:Uh, or isn't it much more likely that the person who first found this particular Alligator mitochondrion sequence happened to match it against a different sample, not the one that the gamemakers used to build sample10000101.txt? Then these differences mean nothing. Were the gamemakers really counting on us identifying the exact sequence they used to build the puzzle, even though we only have a version with mismatches, and then compare the two and produce something meaningful? That seems most dubious. I attribute this to the original being "Close, but no cigar" - e.g., this sample sequence is, say, from some other Alligator, and we haven't found it yet.
I changed my mind. This is obviously the right sequence, there's nothing else in NR (the nucleotide database) even close - the only other alligator mitochondrial genome has only 83% identity. So that was the base sequence they used... Deliberate, but random mutations? They certainly don't look like the real pattern of mutations you'd expect to see... Dunno if they'd encode a message this way.
Actually I'm going to suggest that the entire purpose of this thing is exposition. We already have our link to server 5 via the Boomerang and the StarImages (finally), so I think this is just storytelling - showing us that the Forerunner made extensive catalogs of creatures all over the galaxy, even the lowly alligator on Earth, and then recorded the data in NCBI-approved format, after it scanned clean of any Flood genetic signatures (whatever those might be). Does the Flood have DNA? Seems unlikely...