[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 483: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 112: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 112: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 112: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/bbcode.php on line 112: preg_replace(): The /e modifier is no longer supported, use preg_replace_callback instead
[phpBB Debug] PHP Warning: in file /includes/session.php on line 1035: Cannot modify header information - headers already sent by (output started at /includes/functions.php:3760)
[phpBB Debug] PHP Warning: in file /includes/functions.php on line 4581: Cannot modify header information - headers already sent by (output started at /includes/functions.php:3760)
[phpBB Debug] PHP Warning: in file /includes/functions.php on line 4583: Cannot modify header information - headers already sent by (output started at /includes/functions.php:3760)
[phpBB Debug] PHP Warning: in file /includes/functions.php on line 4584: Cannot modify header information - headers already sent by (output started at /includes/functions.php:3760)
[phpBB Debug] PHP Warning: in file /includes/functions.php on line 4585: Cannot modify header information - headers already sent by (output started at /includes/functions.php:3760)
args.bungie.org - View topic - sample1000101.txt
View unanswered posts | View active topics It is currently Mon Oct 21, 2019 12:49 am



Reply to topic  [ 74 posts ]  Go to page Previous  1, 2, 3, 4, 5 ... 8  Next
 sample1000101.txt 
Author Message
Data [Conditional]

Joined: Wed Aug 08, 2007 12:27 am
Posts: 30
Unread post Re: sample1000101.txt
Aren't these sequences of 10-digits letters smiliar to the ones found in the video?

Image


Thu Aug 09, 2007 10:19 pm
Profile
Data [Conditional]

Joined: Thu Jul 12, 2007 2:29 pm
Posts: 11
Unread post Re: sample1000101.txt
Like the wiki says, the centimorgan calculation helps with figuring out how often a gene is passed/changed as a cell divides.

In this case, since we're working with the mitochondrial DNA, they're really getting at whole organism evolution. This is the kinda stuff they do to say all humans came out of a special bunch in Africa or Australia or whatever it is, or to say that everyone is linked to Genghis Khan.
Check out:
http://en.wikipedia.org/wiki/Mitochondr ... ic_studies

Umm, okay. Let me play with it some more.


Thu Aug 09, 2007 10:23 pm
Profile
Moderator [Designated]
User avatar

Joined: Wed Jun 13, 2007 10:27 pm
Posts: 394
Location: Jackson, MI
Unread post Re: sample1000101.txt


Thu Aug 09, 2007 10:24 pm
Profile WWW
Data [Authenticated]

Joined: Mon Jun 18, 2007 5:16 am
Posts: 141
Unread post Re: sample1000101.txt
well if theres another week gap, i think someone will end up doing it


Thu Aug 09, 2007 10:26 pm
Profile YIM
Data [Authenticated]

Joined: Thu Jun 14, 2007 11:37 am
Posts: 77
Unread post Re: sample1000101.txt
wait a second wanst there a speculation a couple of weeks back that the flood had something to do with amino acids?

(i cant belive i missed all the excitement of server 4, damn laptop just got shipped back to best buy today /cry)


Thu Aug 09, 2007 10:30 pm
Profile
Data [Conditional]

Joined: Thu Jul 12, 2007 2:29 pm
Posts: 11
Unread post Re: sample1000101.txt
Yeah, there are a handful of differences between the sample and the alligator genome in the NCBI database.

http://www.ncbi.nlm.nih.gov/sites/entre ... arch=16824

There are exactly 32 points where the sequences differ.

Normally this wouldn't be that odd, but almost all of them are in areas coding for genes.

Sample: TGGCAATTTGTTTTGAATAGGGGTTTTATCCC
Alligator: AAATCCAAATAACCTCTATACAAACCAGCATA

If you pull out the differences from the amino acid codes, this is what you would get.
Sample: LGNKLF-WL-G-FASCI-SPQ
Alligator: --TNHYKLKQCSLTTWTKGLK

Since this is mitochondrial DNA, these are some relatively important proteins/RNAs that they're screwing with. Also, since this is mitochondrial DNA, remember that the DNA to amino acid transition isn't exactly the same as for regular DNA. If you change it from DNA to protein, these are the differences that pop out. The (-) represents a stop codon.

You could translate the difference sections into one-letter amino acid codes as:
Sample: WQFVLN-GFI
Alligator: KSK-PLYKPA

There’s a bunch more you could do to take this further, but yeah, at first glance I’m not seeing anything that jumps out.


Fri Aug 10, 2007 12:09 am
Profile
Data [Conditional]

Joined: Wed Jul 25, 2007 11:14 pm
Posts: 23
Unread post Re: sample1000101.txt
read through a bunch of info and no one pointed this out yet. the numbers on the page start at 1 and increase +60 every break. between every number is 60 characters. character counter?

-squirrel-


Fri Aug 10, 2007 12:24 am
Profile
Data [Conditional]

Joined: Wed Aug 08, 2007 12:27 am
Posts: 30
Unread post Re: sample1000101.txt


Fri Aug 10, 2007 12:37 am
Profile
Data [Conditional]

Joined: Thu Jun 14, 2007 3:05 am
Posts: 39
Unread post Re: sample1000101.txt


Fri Aug 10, 2007 12:52 am
Profile
Data [Authenticated]

Joined: Mon Jun 25, 2007 12:59 pm
Posts: 221
Location: KW, Ontario
Unread post Re: sample1000101.txt


Fri Aug 10, 2007 12:54 am
Profile WWW
Display posts from previous:  Sort by  
Reply to topic   [ 74 posts ]  Go to page Previous  1, 2, 3, 4, 5 ... 8  Next

Who is online

Users browsing this forum: No registered users and 6 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
cron
Powered by phpBB © 2000, 2002, 2005, 2007 phpBB Group.
Designed by STSoftware for PTF.