View unanswered posts | View active topics It is currently Tue Jul 17, 2018 7:29 pm



Reply to topic  [ 74 posts ]  Go to page 1, 2, 3, 4, 5 ... 8  Next
 sample1000101.txt 
Author Message
Data [Undefined]

Joined: Thu Aug 09, 2007 6:20 pm
Posts: 3
Unread post sample1000101.txt
For the curious,

http://www.genome.jp/dbget-bin/www_bget?refseq+NC_004448

Alligator sinensis mitochondrion, complete genome. Seems that the forerunners got themselves a new pet.

One of these by the looks of things
http://en.wikipedia.org/wiki/Chinese_Alligator

-- APF


Last edited by APF on Thu Aug 09, 2007 6:25 pm, edited 1 time in total.



Thu Aug 09, 2007 6:23 pm
Profile
Data [Authenticated]

Joined: Sat Jun 30, 2007 2:56 am
Posts: 55
Unread post Re: sample1000101.txt
yet another interesting post by someone who just joined...


Thu Aug 09, 2007 6:25 pm
Profile
Moderator [Designated]
User avatar

Joined: Wed Jun 13, 2007 10:27 pm
Posts: 394
Location: Jackson, MI
Unread post Re: sample1000101.txt
Odd, the genomes look identical except for the first 20 nucleotides.


Thu Aug 09, 2007 6:30 pm
Profile WWW
Data [Conditional]

Joined: Thu Jul 26, 2007 11:41 pm
Posts: 23
Unread post Re: sample1000101.txt
I translated the dna sequence and heres what I got:


WARNING: THIS IS A LONG CODE...
Spoilers (hover to reveal):
Forward Frame 1:

1 P L R E T K R A Q - P P R L A R Q V K V
1 CCCCTGAGGGAGACTAAACGAGCACAATAGCCTCCCAGGCTAGCACGTCAGGTCAAGGTG

21 Q P M R W K R - A T F S N T - K Y A T E
61 CAGCCAATGAGGTGGAAGAGATGAGCTACATTTTCTAACACATAGAAATATGCAACGGAG

41 S P V K P G L S K Q D L A V N - E K R A
121 AGCCCTGTGAAACCAGGGCTGTCAAAGCAGGATCTAGCAGTAAACTAGGAAAAGAGAGCC

61 - L K - A T K C V H T A R H P L Q A R -
181 TAATTGAAGTAGGCCACGAAGTGCGTACACACCGCCCGTCACCCTCTTCAAGCCCGATAG

81 - Y T R P G N E Y N I G - D E V R S - Q
241 TAGTACACGCGCCCCGGCAACGAGTACAACATAGGATGAGATGAGGTAAGGTCGTAACAA

101 G K R T G R C A L E H Q D V A - I K L S
301 GGTAAGCGTACCGGAAGGTGCGCTTTGGAACATCAAGATGTAGCTTAAATAAAGCTTTCA

121 A Y T - K C S P P N H S D T H I S P P P
361 GCTTACACCTGAAAATGTTCACCACCGAACCATTCTGACACCCACATTAGCCCACCCCCC

141 P P I P D K F E L K H L - H P S I G E R
421 CCCCCCATACCTGACAAGTTTGAACTAAAACATTTATAACACCCCAGTATTGGTGAAAGA

161 K A - R R D R E S T A R E R - N K D K T
481 AAGGCCTAGAGGCGCGACAGAGAAAGTACCGCAAGGGAAAGATGAAACAAAGATAAAACA

181 Q V K H S K D Q P F Y L S H Y G L A N H
541 CAAGTAAAACACAGCAAAGACCAGCCCTTTTACCTTTCGCATTATGGTTTAGCAAACCAC

201 K W Q K E F K S P T P K L S E L L I S R
601 AAGTGGCAAAAAGAATTTAAGTCACCTACCCCGAAACTGAGTGAGCTACTAATCAGCCGC

221 - T - A N P S L W Q K S G K T A - - W -
661 TAAACTTGAGCAAACCCCTCTCTGTGGCAAAAGAGTGGGAAGACTGCTTAGTAGTGGTGA

241 K A Y R T Q - - L A A W E T N F S S T A
721 AAAGCCTACCGAACCCAGTAATAGCTGGCTGCTTGGGAAACGAATTTTAGTTCTACTGCA

261 N S P T P A T T G K E K F S S Y L I G V
781 AACTCTCCTACTCCCGCAACAACGGGCAAGGAAAAGTTTTCAAGCTACTTAATAGGGGTA

281 Q P Y E H R T Q P L P K G N L S Y S H T
841 CAGCCCTATGAACACAGGACTCAACCTCTACCTAAGGGTAATCTGTCTTATTCTCACACC

301 V G L K A A I T - K R Q S - T P K N T N
901 GTGGGCCTTAAAGCAGCCATCACTTAAAAGCGTCAAAGCTAAACCCCTAAAAATACCAAC

321 N K L N P T P Q P S H L I I L K K T M L
961 AACAAACTGAACCCTACACCACAACCAAGCCACCTTATAATATTAAAAAAGACTATGCTA

341 K - V I R K R L S P C A S L H S S - P P
1021 AAATGAGTAATAAGAAAACGACTTTCTCCTTGCGCCAGCCTACATTCTTCATGACCCCCT

361 I N H H T F P H I P A A Q I K G E P L P
1081 ATAAATCATCACACTTTCCCCCACATTCCTGCTGCTCAAATAAAAGGGGAACCCCTTCCC

381 V W L T P T Q A R T G K A - P L Q K E L
1141 GTCTGGTTGACCCCGACACAGGCGCGCACAGGAAAGGCTTAACCTTTGCAAAAGGAACTC

401 G N K D S D W F T K N S P S P L S I W G
1201 GGCAACAAAGACTCCGACTGGTTTACCAAAAACAGCCCCAGCCCTCTTAGTATTTGGGGT

421 D A C P M T T S - M A A V S T T V Q R V
1261 GATGCCTGCCCAATGACTACTAGTTAAATGGCCGCGGTATCTACAACCGTGCAAAGAGTA

441 A - S L V L - I R T S M N G - T R V - L
1321 GCGTAATCACTTGTTCTTTAAATAAGGACCAGTATGAACGGCTAAACGAGAGTCTAACTG

461 S P A S S Q - N - S S C A K A G I A P P
1381 TCTCCTGCAAGCAGCCAATGAAATTGATCTTCCTGTGCAAAAGCAGGAATAGCCCCACCA

481 D E K T L - N F N R L S H T H N - - S P
1441 GACGAGAAGACCCTGTGAAACTTTAATCGGCTAAGTCATACACACAACTAATAATCACCC

501 I I T W T V T - R F W L G - P - N K E K
1501 ATAATTACCTGGACCGTGACTTAGCGTTTTTGGTTGGGGTGACCTTGAAACAAAGAAAAA

521 L L R K L - Q S S Q Y P L R P P H L K V
1561 CTTTTAAGAAAGCTATAACAAAGTAGCCAGTATCCACTGAGACCCCCACACCTCAAAGTA

541 L K C N - I R Q R R S M N Q A T P G I T
1621 CTTAAATGTAATTAGATCCGACAACGTCGATCCATGAACCAAGCTACTCCAGGGATAACA

561 A Q S P S R A P I D R G V Y D L E V G S
1681 GCGCAATCCCCTTCAAGAGCCCCTATCGATAGGGGGGTTTACGACCTCGAGGTTGGATCA

581 G H P I G V T A N N G S F V Q R L K S Y
1741 GGACACCCCATTGGTGTAACCGCTAATAATGGTTCGTTTGTTCAACGTTTAAAGTCCTAC

601 V I L S S D R S N P G R F L S M T P P F
1801 GTGATACTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACCCCGCCTTTT

621 P S T K G P E K Q G P C H - S T P Y P -
1861 CCTAGTACGAAAGGACCGGAAAAACAAGGCCCATGCCACTAAAGTACGCCTTACCCATAG

641 L M - T T K L A T G M N L P L E T R A C
1921 CTAATGTAGACAACTAAACTAGCAACCGGGATGAACCTGCCCCTCGAAACAAGAGCATGC

661 W V G R A W L N A K G L S P L L R D S N
1981 TGGGTTGGCAGAGCCTGGCTCAATGCAAAAGGCCTAAGCCCTTTACTCAGAGATTCAAAT

681 S L P S N R L S H R R A P R S T Y H N H
2041 TCTCTACCCAGTAATAGACTTTCTCATCGTCGTGCCCCCCGCTCTACTTATCATAACCAT

701 P D R G C I F N G P R T K N Y W L H A T
2101 CCTGATCGCGGTTGCATTTTTAACGGCCCTAGAACGAAAAATTATTGGCTACATGCAACT

721 T K R T K H R W P T W P T S T P R R R I
2161 ACGAAAAGGACCAAACATCGTTGGCCCACTTGGCCTACTTCAACCCCTCGCCGACGGATT

741 - T C Y - R T N P P A T C N P S P L H P
2221 TAAACTTGTTATTAAAGAACTAACCCTCCCGCTACTTGCAACCCCAGCCCTCTTCATCCT

761 I P S S S P N A S P Y D M I P P P H A I
2281 ATCCCCAGCAGCAGCCCTAATGCTAGCCCTTACGATATGATCCCCCCTCCCCATGCCATT

781 S P G R P - P R T T I P T G H I K P H G
2341 TCCCCTGGCAGACCTTAACCTAGGACTACTATTCCTACTGGCCATATCAAGCCTCATGGT

801 L L I I M I R V I L K L K I C L N R C P
2401 CTACTCATTATTATGATCCGGGTGATCCTCAAACTCAAAATATGCCTTAATAGGTGCCCT

821 S G S C S N Y L L R S N T G H H C I I Y
2461 TCGGGCAGTTGCTCAAACTATCTCCTACGAAGTAACACTGGCCATCATTGTATTATCTAT

841 C L T D W G I F A T C P H H H T R T P I
2521 TGTCTTACTGACTGGGGGATTTTCGCTACATGCCCTCACCACCACACAAGAACCCCTATA

861 P A L S H L T I D N N M V Y L Y T S R N
2581 CCTGCACTTAGCCACCTGACCATCGATAATAATATGGTATACCTCTACACTAGCAGAAAC

881 K P G P I R P N R G R V R A S I R I - R
2641 AAACCGGGCCCCATTCGACCTAACAGAGGGAGAGTCAGAGCTAGTATCCGGATTTAACGT

901 - I R R K P L R T L F P G R V R Q H Y I
2701 TGAATACGGCGCAAGCCCCTTCGCACTCTTTTTCCTGGCCGAGTACGCCAACATTATATT

921 N K H P D C H P I L K P I Y P H F H P N
2761 AATAAACACCCTGACTGTCACCCTATTCTTAAACCCATCTACCCCCACTTCCATCCCAAT

941 T L H H R P N K Q N P S T N Y K L S M N
2821 ACTCTTCACCATCGCCCTAATAAGCAAAACCCTTCTACTAACTATAAGCTTTCTATGAAT

961 P S I L P P I S L - P A F A P F M K K L
2881 CCGAGCATCCTACCCCCGATTTCGCTATGACCAGCTTTTGCACCTTTTATGAAAAAGCTT

981 P T H N I S P L P M T L I T S N I N I W
2941 CCTACCCACAACATTAGCCCTCTGCCTATGACACTCATCACTTCCAATATCAACATTTGG

1001 A A P N N I G P C L N R N R A L - - S R
3001 GCTGCCCCCAACAACATAGGACCGTGCCTGAATCGCAATAGGGCTCTTTGATAGAGTAGA

1021 Q Q G L E P P R I L E E - G S N L L K R
3061 CAACAGGGGTTAGAACCCCCTCGCATCCTAGAGGAGTAGGGTTCGAACCTACTCAAAAGG

1041 N Q N P S Y F L Y S T P - K C K L I K A
3121 AATCAAAATCCTTCCTACTTCCTTTATAGTACCCCCTAGAAGTGTAAGCTAATTAAAGCT

1061 I G P I P Q K - G L T P F T P T T C P S
3181 ATTGGGCCCATACCCCAAAAATAAGGGCTAACCCCCTTCACTCCTACCACATGCCCCTCT

1081 P S Q L S - R P - P P Q H S S F Y Y Q P
3241 CCCAGCCAATTATCTTAACGACCCTGACCGCCACAACACTCGTCTTTCTACTATCAACCC

1101 T L Y - Y E P H - N L A H - Q S S P - S
3301 ACCTTGTACTAATATGAGCCGCACTAGAACTTAGCACACTAGCAATCCTCCCCCTAATCG

1121 L I N P T P E L S K L L Q N T F - Y K R
3361 CTAATAAATCCCACCCCCGAGCTATCGAAGCTTCTACAAAATACTTTTTAATACAAGCGA

1141 - P P H - S S S Q E R S T M K - Q E V T
3421 TAGCCTCCACACTAATCATCTTCTCAGGAGCGCTCAACTATGAAATAACAGGAAGTTACC

1161 K S Q S - R T - P Q - L C - P S P C L L
3481 AAATCGCAGAGTTAACGGACTTAACCTCAATAATTGTGCTAACCCTCGCCCTGTTTATTA

1181 K W D - C H S T S E Y Q K S Y K E Y P Q
3541 AAGTGGGACTAGTGCCATTCCACTTCTGAGTACCAGAAGTCCTACAAGGAATACCCACAG

1201 L L Q S F Y - H G R S - A H - L Y S S -
3601 CTCCTGCAATCTTTCTACTGACATGGCAGAAGCTAGGCCCACTAGTTATACTCTTCTTAA

1221 L A T S S A L N - S L - W P S Y P L L L
3661 TTAGCCACCTCATCAGCCTTAAACTAATCTTTATAGTGGCCGTCTTATCCTCTCTTATTG

1241 Q V G - D - I K L K Y E N - - H S H P S
3721 CAGGTTGGATAGGACTAAATCAAACTCAAGTACGAAAACTAATAGCATTCTCATCCATCG

1261 P K W H E L L - S L N T P H P - Q S - L
3781 CCCAAATGGCATGAATTATTGTAATCATTAAATACGCCCCATCCCTGACAATCCTGACTT

1281 F I S I P L P S P P H Y S H - I K Y Q Q
3841 TTTATATCTATTCCACTACCGTCTCCGCCACACTACTCACACTAGATAAAATATCAACAA

1301 P P P N T S L P P S Q N P R L Q P P S -
3901 CCTCCACCAAACACCTCATTACCTCCTTCTCAAAATCCCCGACTGCAGCCACCCTCCTAA

1321 L S P Y S R Y P A F H P W P A F C Q N G
3961 CTCTCTCCCTACTCTCGCTATCCGGCCTTCCACCCCTGGCCGGCTTTCTGCCAAAATGGC

1341 - P L I N L S Q K K Q L E S L S S Y S W
4021 TAACCGTTAATCAACTTGTCTCAGAAAAAGCAGCTTGAATCGCTCTCCTCATACTCATGG

1361 P P S - A F S S I F G Y G T T P H R P Y
4081 CCTCCCTCTTAAGCCTTTTCTTCTATCTTCGGCTATGGTACAACTCCTCATCGACCCTAC

1381 R Q I P Q T Q P A S D E N - P L K A T -
4141 CGCCAAATACCACAAACACAACCCGCCTCTGACGAAAACTAACCCCTCAAAGCAACCTAA

1401 P L T S L S W L P P P F C Y P P H - - K
4201 CCATTAACCTCCTTGTCCTGGCTGCCACCACCCTTCTGCTATCCGCCACATTAATGAAAG

1421 Q L P N K K P P K L K E I R F K L Q A E
4261 CAATTACCAAACAAGAAACCCCCAAAGCTAAAAGAAATTAGGTTCAAACTTCAAGCCGAG

1441 G L Q S P K W E - T N P H F L I - G L R
4321 GGCCTTCAAAGCCCTAAATGGGAGTAAACAAACCCCCATTTCTTGATTTAAGGTTTGCGG

1461 D S I P H F Q N A N Q K L - L S - N L N
4381 GACTCTATCCCACATTTTCAGAATGCAAATCAAAAGCTTTAATTAAGCTAAAACCTCAAT

1481 K Q E G F D P T N I - L T A K R S N - R
4441 AAACAGGAGGGCTTTGATCCCACAAATATTTAATTAACAGCTAAACGCTCCAACTAACGA

1501 A S V Y S K P Q Y Y L K Y I Y E F A I R
4501 GCTTCTGTTTATTCCAAGCCTCAGTACTACCTAAAGTACATCTACGAATTTGCAATTCGC

1521 H E F H H E A - - R G E L N P C K - I Y
4561 CATGAATTTCACCATGAGGCCTAGTAAAGAGGGGAATTAAACCCCTGTAAATAGATTTAC

1541 S L A P S T L G H F T C E R P P L I I L
4621 AGCCTAGCGCCATCAACACTCGGCCACTTTACCTGTGAACGCCCACCGTTGATTATTCTC

1561 Y - P Q R H W H P L L R L W N M S R N S
4681 TACTAACCACAAAGACATTGGCACCCTTTACTTCGTCTTTGGAACATGAGCCGGAATAGT

1581 G N S T K P P Y S N R I K P A R A P P R
4741 GGGAACAGCACTAAGCCTCCTTATTCGAACAGAATTAAGCCAGCCAGGGCCCCTCCTAGG

1601 R R P N L Q R N C H R P C L Y Y N L F H
4801 AGACGACCAAATCTACAACGTAATTGTCACCGCCCATGCCTTTATTATAATCTTTTTCAT

1621 S N T H H D R R I W K L T T T P D N R S
4861 AGTAATACCCATCATGATCGGCGGATTTGGAAACTGACTACTACCCCTGATAATCGGAGC

1641 P R Y S I P P S K Q H K L L I A P P I L
4921 CCCAGATATAGCATTCCCCCGAGTAAACAACATAAGCTTTTGATTGCTCCCCCCATCCTT

1661 H T S T L L R L R R G G G R N R V N C L
4981 CATACTTCTACTCTCCTCCGCCTGCGTCGAGGCGGGGGCCGGAACAGGGTGAACTGTCTA

1681 P A P R R K F S P R R T V R R F D N L L
5041 CCCGCCCCTCGCCGGAAATTTAGCCCACGCCGGACCGTCCGTAGATTTGACAATCTTCTC

1701 S S S R R S I L Y P W C Y - F H Y N S N
5101 TCTTCATCTCGCCGGAGTATCCTCTATCCTTGGTGCTATTAATTTCATTACAACAGCAAT

1721 - H K T P S N I P I P N T L I C M V R P
5161 TAACATAAAACCCCCAGCAATATCCCAATACCAAACACCCTTATTTGTATGGTCCGTCCT

1741 N Y S R A P S T I P T S T S C W N H H T
5221 AATTACAGCCGTGCTCCTTCTACTATCCCTACCAGTACTAGCTGCTGGAATCACCATACT

1761 P Y R S Q L K Y N L L R P R G R R R P H
5281 CCTTACAGATCGCAACTTAAATACAACCTTCTTCGACCCCGCGGGCGGAGGAGACCCCAT

1781 P I P T P F L I L W P P R S I H P H P P
5341 CCTATACCAACACCTTTTCTGATTCTTTGGCCACCCCGAAGTATACATCCTCATCCTCCC

1801 W I R N N F P R G R L L L R R K G T I R
5401 TGGATTCGGAATAATTTCCCACGTGGTCGCCTTTTACTCAGGCGAAAAGGAACCATTCGG

1821 L Y R N G M S H T L Y R I P R I H C L G
5461 CTATATAGGAATGGCATGAGCCATACTCTCTATCGGATTCCTAGGATTCATTGTCTGGGC

1841 P P H I Y S R N R R R H P S I L H H R H
5521 CCACCACATATTTACAGTCGGAATAGACGTCGACACCCGAGCATACTTCACCACCGCCAC

1861 N S Y R Y P H R S K S I - L T C H H L R
5581 AATAGTTATCGCTATCCCCACCGGAGTAAAAGTATTTAGCTGACTTGCCACCATCTACGG

1881 R H C Q L T S P D T L S T W F H L L V H
5641 CGGCATTGTCAACTGACAAGCCCCGATACTCTGAGCACTTGGTTTCATCTTCTTGTTCAC

1901 S R G P H W H R P S - L L T R Y C S P -
5701 AGTAGGGGGCCTCACTGGCATCGTCCTAGCTAACTCCTCACTAGATATTGTTCTCCATGA

1921 H L L C S R P L P L R T V N G G S L R H
5761 CACCTATTATGTAGTCGCCCACTTCCACTACGTACTGTCAATGGGGGCAGTCTTCGCCAT

1941 Y K W I H P L D S L L F T G F T L H P T
5821 TATAAGTGGATTCACCCACTTGATTCCCTCTTATTTACGGGATTTACCCTTCACCCAACA

1961 - T K N P I Y N Y I C G G K F Y L L P T
5881 TGAACTAAAAATCCAATTTATAATTATATTTGTGGGGGTAAATTTTACCTTCTTCCCACA

1981 T L P R P L R D T P T L F G L P R R I H
5941 ACACTTCCTAGGCCTCTCCGGGATACCCCGACGCTATTCGGACTACCCAGACGCATACAC

2001 P L K P I I I Y W V P N L N N R S R P A
6001 CCTCTGAAACCTATTATCATCTATTGGGTCCCTAATCTCAATAACCGCAGTCGTCCTGCT

2021 H I Y C M R S I L I Q T K S N S T R N D
6061 CATATTTATTGTATGAGAAGCATTCTCATCCAAACGAAAAGTAACAGCACTCGAAATGAC

2041 N D Q H R M A Q Q L P P I P S H L - R A
6121 AACGACCAACATCGAATGGCTCAACAACTGCCCCCCATCCCATCACACCTATGAAGAGCC

2061 R I C P S A N L L - N I P P S L K N G G
6181 CGTATTTGCCCTAGTGCAAACCTCCTTTAAAACATACCACCCAGCCTCAAGAACGGAGGG

2081 N R T P T S G F - A S R Y T A M L H S P
6241 AATCGAACCCCCACCTCTGGTTTCTAAGCCAGCCGCTACACCGCCATGCTCCATTCTCCT

2101 Q R R I S I L R I T C S C Q E Q K I G H
6301 CAAAGAAGGATTAGTATACTTCGTATTACCTGTTCTTGTCAAGAGCAAAAAATAGGACAC

2121 - I L Y P S I A N P I H L G F Q D A I S
6361 TAAATCCTATACCCTTCTATAGCTAACCCGATACACTTAGGATTCCAAGATGCAATATCC

2141 P L I E E L L Y F H D H T L I I L F L I
6421 CCTCTGATAGAAGAATTACTGTATTTCCACGACCACACGCTGATAATCCTATTTCTAATC

2161 S S L V F Y I I S A L L L P K L Y H S S
6481 AGCTCCCTCGTATTCTACATAATTTCCGCCCTCCTCCTCCCCAAACTCTACCACTCGAGC

2181 A S D V Q E V E V I - T I L P A I V L I
6541 GCCTCAGACGTCCAAGAAGTAGAAGTAATCTGAACTATCCTGCCCGCTATTGTCCTCATC

2201 S V A L P S L R T L Y L M D E T N N P C
6601 TCAGTCGCCCTTCCATCACTTCGTACCCTTTACCTCATGGACGAAACCAACAACCCCTGC

2221 L T I K A T G H Q - Y - S Y E Y T D F S
6661 CTTACTATTAAAGCAACCGGACACCAATGATATTGATCCTATGAATACACCGATTTCTCT

2241 A L E F D S Y I V P T Q D L P L G H F R
6721 GCACTAGAATTCGACTCCTACATAGTACCCACACAAGACCTGCCTCTAGGCCACTTCCGT

2261 L L E V D H C M I T P T N S T I R V L I
6781 CTTCTAGAAGTTGACCACTGCATGATTACTCCAACAAACTCAACCATCCGAGTACTAATT

2281 T A E D V L H S W A I P S I G T K I D A
6841 ACAGCCGAAGATGTGTTGCACTCATGGGCCATCCCGTCCATCGGAACAAAAATAGACGCA

2301 R P G R L N Q V I L T L A N S G V F Y G
6901 CGTCCAGGGCGCCTAAACCAGGTCATACTCACACTGGCCAATTCCGGTGTATTTTACGGC

2321 Q C S E I C G A N H S F I P I V I E T I
6961 CAATGCTCCGAAATCTGCGGGGCAAACCACAGCTTCATACCCATTGTCATAGAAACTATC

2341 P L N H F Q L - L K D C M S S S L R S -
7021 CCATTAAACCACTTCCAACTCTGACTAAAAGACTGCATGTCCTCCTCACTAAGAAGCTAA

2361 M V S T S L L S - N - G I N T D L S P L
7081 ATGGTTAGCACTAGCCTTTTAAGTTAGAATTAGGGGATTAACACCGACCTCTCCCCCTTA

2381 V T M P Q L N P E P - L T T L L I T - I
7141 GTGACCATGCCCCAACTAAACCCAGAGCCTTGACTAACAACCCTTCTAATCACATGAATT

2401 S F I A F L Q P K I T S P A P V N D P T
7201 TCCTTCATCGCCTTCCTTCAACCCAAGATTACCTCCCCCGCACCTGTAAACGACCCAACT

2421 T R K P P T I K T - P - P - T Q T C L I
7261 ACCCGCAAACCCCCAACCATTAAAACATGACCCTGACCGTGAACACAAACCTGTTTGATC

2441 N S - S Q A S - A S P Y - C R P Y - - L
7321 AATTCCTAATCCCAAGCCTCCTAGGCATCTCCCTATTAATGCCGGCCCTACTAATAACTG

2461 P F S F - T L K I N D Y H T Q Q - Q S N
7381 CCATTCTCCTTTTAAACCCTAAAAATCAATGACTATCACACCCAACAGTAACAATCAAAT

2481 L V L L I K L Q N K S C F L S A P Q G G
7441 CTTGTTTTATTAATAAAGCTACAAAACAAATCATGCTTCCTATCAGCCCCTCAGGGCGGA

2501 N N P - S S S P Y - S S F S L L T C L A
7501 AACAATCCTTAATCCTCATCTCCTTATTAATCCTCCTTCTCTTTACTAACCTGCTTGGCC

2521 Y F H T P S P Q Q H N Y L - T - P S A F
7561 TACTTCCATACACCTTCACCCCAACAACACAACTATCTATAAACATAGCCCTCGGCCTTC

2541 L Y G W Q Q Y - S G F G P A Q R P P W A
7621 CTCTATGGCTGGCAACAGTATTAATCGGGCTTCGGACCCGCCCAACGGCCTCCCTGGGCC

2561 T F F Q E G P P P S L S R A - S - S R Q
7681 ACCTTCTTCCAGGAGGGACCCCCACCCTCCTTATCCCGGGCCTAATCTTGATCGAGACAA

2581 L A Y - F D Q S P - V S D - Q Q T - L R
7741 TTAGCCTACTAATTCGACCAATCGCCCTAGGTGTCCGACTAACAGCAAACCTAACTGCGG

2601 A T Y - F N - S Q S P H - T S D P - Y P
7801 GCCACCTACTAATTCAATTAATCTCAATCGCCACATTAAACCTCTGATCCATAATACCCC

2621 H L A Y - P - Q S - F S S Y Y - N L L W
7861 CACTTAGCCTATTGACCTTGACAGTCCTGATTCTCCTCTTATTACTAGAATTTGCTGTGG

2641 P - S K P T S S S S Y Y P Y T F K K T R
7921 CCATAATCCAAGCCTACGTCTTCGTCCTCCTATTATCCCTATACCTTCAAGAAAACACGT

2661 N V T P N T L L S H S P P Q P L T P R R
7981 AATGTCACACCAAACACACTCCTTTCACATAGTCCACCCCAGCCCCTGACCCCTCGCCGG

2681 G H S R H I I N N R P D L L I P L - L -
8041 GGCCATAGCCGCCATATTATTAACAACAGGCCTGACCTTCTGATTCCACTATGACTCTAG

2701 P Y S I A R P N H H S I S N T P M M T R
8101 CCTTATTCTATTGCTCGGCCTAATCACCACTCTATTAGTAATACTCCAATGATGACGAGA

2721 H Y P R K H L P R T P H T C S T K R T T
8161 CATTATCCGAGAAAGCACCTACCTAGGACACCACACACCTGCAGTACAAAAAGGACTACG

2741 L R H N P F Y H I R G L L L P G L L L S
8221 CTACGGCATAATCCTTTTTATCACATCAGAGGTCTTCTTCTTCCTGGGCTTCTTCTGAGC

2761 I L S L K P F P H P - A R G T V T P S R
8281 ATTTTATCACTCAAGCCTTTCCCCCACCCCTGAGCTAGGGGGACAGTGACCCCCAGTCGG

2781 N Y H P - P I - S S P P K H S C P P C L
8341 AATTACCACCCTTGACCCATTTGAAGTTCCCCTCCTAAACACAGCTGTCCTCCTTGCCTC

2801 W G N S N L G P P Q L D G S Q P N T S N
8401 TGGGGTAACAGTAACCTGGGCCCACCACAGCTTGATGGAAGCCAACCGAACACAAGCAAT

2821 S G P N T H R T P W P I L H R P S S H R
8461 TCAGGCCCTAACACTCACCGTACTCCTTGGCCTATACTTCACCGCCCTTCAAGCCATAGA

2841 V L R S P L Y N R R Q H L R I N I L R C
8521 GTACTACGAAGCCCCCTTTACAATCGCAGACAGCACCTACGGATCAACATTCTTCGTTGC

2861 N R L P R P P C Y Y W L N I S H S L P I
8581 AACCGGCTTCCACGGCCTCCATGTTATTATTGGCTCAACATTTCTCATAGTCTGCCTATA

2881 S T D K I S L H I Q P P L R V R S R C L
8641 TCGACAGACAAAATATCACTTCACATCCAACCACCACTTCGGGTTCGAAGCCGCTGCCTG

2901 I L T F C R C R L T L P L H L N L L M R
8701 ATATTGACATTTTGTAGATGTCGTCTGACTCTTCCTTTACATCTCAATCTACTGATGAGG

2921 F M L F - Y K - Y K - L P I T K P L T H
8761 TTCATGCTCTTCTAGTATAAATAATACAAGTGACTTCCAATCACTAAACCCCTAACACAC

2941 N K G K S N Q P S Y H I H S N L H H R R
8821 AACAAGGGGAAAAGCAATCAACCTTCTTACCATATTCATAGTAACCTCCATCACCGCCGC

2961 S R N H Y K P A N N - N T T - L R K T I
8881 AGCCGTAATCACTATAAACCTGCTAATAACTGAAATACTACCTGACTCAGAAAAACTATC

2981 P L R V R I - P P R L C S P T P I N S I
8941 CCCCTACGAGTGCGGATTTGACCCCCTCGGCTCTGCTCGCCTACCCCTATCAATTCGATT

3001 F H D R H L I P T F R S - N R Y P A P T
9001 TTTCATGATCGCCATCTTATTCCTACTTTTCGATCTTGAAATCGCTATCCTGCTCCCACT

3021 H M S H P R P K P P K N R H M G H H Y L
9061 CACATGAGCCACCCACGCCCTAAACCCCCTAAAAACCGCCACATGGGCCATCATTATCTT

3041 P I L I H R I N I R M T P G R P R M S R
9121 CCTATTCTTATTCATCGGATTAACATACGAATGACTCCAGGGCGGCCTAGAATGAGCAGA

3061 I A N P Q R T S L T - D L - L R L R R S
9181 ATAGCCAACCCCCAAAGAACTAGTCTAACATAAGACCTCTAACTTCGACTTAGAAGATCA

3081 R L T P R F Y I I T S I S V I F L Y S F
9241 CGATTAACCCCGCGGTTCTATATAATCACATCCATAAGCGTCATATTTTTATACTCCTTC

3101 V I C T I G L I I H H T H L L S T L L C
9301 GTCATCTGCACCATCGGCCTAATCATACACCACACACACCTACTCTCAACACTACTATGT

3121 L E G M I L S I F M A L T I S A L S S N
9361 CTTGAGGGTATGATACTGTCAATTTTCATGGCCTTGACAATATCAGCGCTCAGTTCAAAC

3141 T S S F I L P L T I L T L S A C E A G V
9421 ACCTCCTCATTCATCCTGCCACTAACAATTCTAACCCTTTCTGCCTGTGAAGCAGGCGTC

3161 G L A L L V A S A R T H N T A N L K N L
9481 GGCCTGGCCCTACTGGTTGCCTCTGCTCGAACACATAACACAGCAAACCTTAAAAACCTA

3181 N L L Q C - N F F F P Q P C - S Q Q S T
9541 AACCTCCTCCAATGCTAAAACTTCTTCTTCCCACAACCATGCTGATCCCAACAATCAACC

3201 S S Q T K L P G C R Q Q P T R L S - - P
9601 TCCTCCCAAACAAAATTACCTGGTTGCCGCCAACAGCCTACTCGATTGTCGTAATGACCC

3221 - P S - S S T H L T L L - P L A A W P -
9661 TAGCCCTCCTAATCCTCAACCCATCTGACACTCTTATAGCCACTAGCCGCCTGGCCCTAG

3241 V A I N S Q P L - - F C P A D F S P - Y
9721 GTAGCGATCAATTCTCAACCCCTTTAATAATTCTGTCCTGCTGACTTCTCCCCTTAATAC

3261 L - P A K V L Y S K T P P P K I T Y L S
9781 TTATAGCCAGCCAAAGTTCTATATTCAAAAACCCCGCCCCCCAAAATCACATATTTATCA

3281 Q S L Q Y F N L L Y L W H L W P - T - Y
9841 CAATCCTTGCAATACTTCAACTTGCTCTACTTATGGCATTTATGGCCCTAGACTTAATAC

3301 Y S T S P S K P P - S P P L - S S P A E
9901 TATTCTACATCTCCTTCGAAGCCACCCTAATCCCCACCCTTGTAATCATCTCCCGCTGAG

3321 G L K Q T A - T Q V F I F C F T L S P A
9961 GGGCTCAAACAGACCGCCTAAACGCAGGTATTTATTTTTTGTTTTACACTATCGCCAGCT

3341 Q S R - - L A P W - P T T - K G L Y L S
10021 CAATCCCGCTGATAATTAGCACCTTGGTAACCTACAACCTAAAAGGGACTTTATCTCTCC

3361 P P Y N - F Q - Q T P S P E Q T H F Y D
10081 CCGCCCTACAACTAATTCCAATAGCAAACCCCCTCTCCTGAACAGACACACTTCTATGAC

3381 Y P Y S - P S - - K S P F T A S T C D S
10141 TATCCATACTCCTAGCCTTCCTAGTAAAAATCCCCCTTTACGGCCTCCACCTGTGACTCC

3401 P K L T S K P P L R A P - S - L Q Y S -
10201 CCAAAGCTCACGTCGAAGCCCCCATTGCGGGCTCCATAATCCTAGCTGCAGTACTCCTAA

3421 N L A A T A C Y E - - T Y S P N K - T L
10261 AACTTGGCGGCTACGGCCTGTTACGAGTAGTAAACTTACTCACCGAACAAATAAACACTA

3441 S T S P F - P W R S E G P L - L A L S V
10321 TCTACCTCCCCTTTTTAACCTTGGCGCTCTGAGGGGCCCTTATGACTGGCCTTATCTGTT

3461 C D K L T - N P - L P T H Q - V T - P -
10381 TGCGACAAACTGACCTAAAATCCTTAATTGCCTACTCATCAGTAAGTCACATAGCCCTAG

3481 - R L Q F L R G I N - P Q Q P Q Y F - -
10441 TAACGGCTGCAATTCTTGCGCGGAATCAATTAGCCCCAGCAGCCTCAATACTTCTAATAA

3501 - P T D - H P P C Y S A W Q I S T M N V
10501 TAGCCCACGGACTGACATCCTCCATGCTATTCTGCTTGGCAAATTTCAACTATGAACGTA

3521 L T L G H S W Q Y K V Y N S L H L P L Q
10561 CTCACACTCGGACACTCCTGGCAATACAAGGTATACAACTCACTACACCTGCCCTTACAA

3541 L D D F - L A Q - T - L S P Q Q L T S -
10621 CTTGATGATTTTTAGCTAGCGCAATGAACATAGCTCTCCCCCCAACAATTAACCTCATAG

3561 E N - L L L S H F L A G - T S H Y C - L
10681 GAGAACTAACTATTATTGTCTCACTTTTTAGCTGGCTAGACATCACACTATTGTTAACTG

3581 D - A H S L Q Q S T P S T Y S H P P N K
10741 GACTAAGCTCATTCATTACAGCAATCTACACCCTCCACATATTCTCATCCACCCAACAAG

3601 E H Y P P T P P S S H L P K P E N T S -
10801 GAACACTACCCGCCCACACCACCCTCCTCCCACCTGCCCAAACCCGAGAACACCTCCTAA

3621 Y Y F T H Y H R L F S S P T P N S S S P
10861 TACTACTTCACTCACTACCATCGATTATTCTCATCGCCAACCCCCAACTCATCTTCCCCC

3641 N S P N N P P H D L L N P T T R R I T Q
10921 AATAGCCCCAACAACCCACCCCATGATCTATTGAACCCCACTACGAGAAGGATCACGCAG

3661 E L - L P L P E L I T W P S H Y R P H I
10981 GAACTCTAACTCCCGCTCCCAGAATTAATCACCTGGCCCTCTCATTATAGACCCCATATC

3681 W V S I V - T K H - N V N L K T G Y - P
11041 TGGGTAAGTATAGTTTAAACAAAACATTAGAATGTGAACCTAAAAACAGGATACTAACCA

3701 I L P Y P P P F S - V T S T S S G L R G
11101 ATCCTTCCTTACCCCCCCCCGTTTTCATAGGTAACCAGTACATCCTCTGGCCTTAGGGGC

3721 R Q S R C N P K - K H M Q Q S T L F V T
11161 CGGCAATCTCGGTGCAACCCAAAGTGAAAACACATGCAACAATCAACCCTATTTGTTACA

3741 L F T L P P F I L V L S C S L P A P K T
11221 CTATTCACCCTACCCCCCTTCATCCTCGTACTATCCTGCTCCCTCCCAGCCCCCAAAACC

3761 L H P A D F K S I I T K L A F L Q S L P
11281 CTCCACCCGGCTGACTTTAAAAGTATAATAACTAAACTGGCATTCTTGCAAAGCCTCCCT

3781 P L L L L V Y N N T T A L S F Q - H - L
11341 CCCCTCCTCTTATTAGTCTATAACAACACAACCGCTCTCTCATTCCAATGACACTGACTC

3801 N V G T C S V H L G L K V D T F S V F F
11401 AACGTAGGAACTTGCTCTGTTCACCTGGGCCTTAAAGTTGACACCTTCTCAGTCTTCTTT

3821 I P T A L F V T - S I I E F T K A Y I Y
11461 ATCCCAACAGCCTTATTCGTCACATGATCAATCATAGAGTTCACCAAAGCATACATATAC

3841 S D P K I T S F F N H L L I F I L M M I
11521 TCAGACCCCAAAATCACCAGCTTCTTTAACCACCTCCTAATTTTTATTCTAATGATGATC

3861 L L I S A N N L L I L F V G - E G V G I
11581 CTTCTAATCTCCGCTAACAACTTACTCATATTATTCGTGGGCTGAGAGGGAGTAGGCATC

3881 L S F K L I N - - S F R A D S N K A A L
11641 TTGTCGTTCAAGCTCATCAACTGATGATCCTTCCGAGCGGACTCTAACAAGGCAGCCCTA

3901 Q A I I Y N R L A D I G I L A S I S - M
11701 CAGGCCATCATTTACAACCGCCTAGCAGATATCGGAATACTCGCTAGCATTTCATGAATG

3921 A L N S L T L D A Q D V P I S P D H S L
11761 GCCCTAAATAGCCTCACCCTCGACGCCCAAGACGTCCCCATATCCCCCGACCACTCACTC

3941 I L A I A L V L A A A G K S A Q F G F H
11821 ATCCTAGCCATAGCCCTTGTCCTAGCAGCAGCTGGAAAATCAGCCCAATTTGGCTTCCAT

3961 P W L P A A I E G P T P V S A L L H S S
11881 CCCTGGCTCCCAGCAGCCATAGAGGGCCCCACACCAGTCTCAGCCCTACTCCACTCAAGC

3981 T I V V A G I F L L I R T S H I I Y S S
11941 ACCATAGTAGTAGCAGGCATTTTCTTATTAATCCGAACCTCCCACATCATCTACAGCAGC

4001 Q T A T T A C L L L G A A T S L L T A A
12001 CAAACAGCAACCACAGCCTGCCTGCTCCTAGGAGCAGCAACCTCCCTGCTCACAGCTGCC

4021 C A L T Q N D M K K I I A F S T S S Q L
12061 TGCGCCCTCACCCAAAATGATATGAAGAAGATTATTGCATTCTCAACCTCAAGCCAACTT

4041 G L I M S T I G L K Q P E L A F L H I S
12121 GGACTAATAATGAGCACAATTGGACTTAAACAGCCCGAACTTGCATTTCTACACATCTCA

4061 T H A F F K A I L F L C A G S I I H S L
12181 ACACATGCCTTTTTTAAAGCAATACTATTCCTGTGCGCAGGGTCAATTATCCATAGCCTT

4081 N N E Q D I R K M G G L K K A I P I T T
12241 AACAACGAGCAAGATATTCGAAAGATGGGCGGCCTTAAAAAAGCAATACCCATCACCACC

4101 S C L T I G A L A L T G I P F L S G F F
12301 TCTTGCTTGACTATTGGAGCATTAGCTCTCACCGGCATACCCTTCCTCTCAGGATTTTTT

4121 S K D A I I E S L N T S Y T S A W A L T
12361 TCCAAAGACGCCATTATTGAATCGCTAAATACCTCATACACTAGCGCCTGGGCCCTTACC

4141 L V L L A T S F T A V Y S F R M I Y F T
12421 CTCGTCCTACTCGCCACCTCCTTCACTGCAGTTTATAGCTTCCGCATGATTTATTTTACC

4161 L L N T N R L T P M N P I N E N P E T V
12481 CTACTAAACACCAACCGCCTAACACCCATGAACCCCATTAATGAAAACCCAGAAACTGTA

4181 N P I I R L A V G S I V A G L L I S T H
12541 AACCCCATCATACGTCTAGCTGTCGGAAGCATTGTAGCCGGGCTATTAATTTCAACCCAC

4201 I L P S N T P Q L T M P G P I K L A A L
12601 ATACTACCCTCTAATACCCCCCAACTAACCATGCCTGGCCCAATCAAACTTGCAGCCCTC

4221 T I T I A G L L V A I A L T Y A T N K F
12661 ACCATCACAATAGCTGGCCTACTAGTCGCAATAGCCCTGACCTACGCCACCAACAAATTC

4241 P P S T N D T Q L P F L T K L A Y F N L
12721 CCCCCATCCACCAACGACACTCAACTGCCCTTCCTAACTAAACTGGCCTACTTCAACCTC

4261 L F H H L F S T T A L Y I S Q K L S T H
12781 CTATTCCACCATCTCTTCTCCACCACTGCCCTTTACATAAGCCAGAAACTATCTACCCAT

4281 L T D Q T - Y E T I G P K T L A Y L Q T
12841 CTGACCGACCAAACATGATACGAAACTATCGGACCAAAAACATTAGCCTATCTTCAAACC

4301 L L A K T I T P Y H K G K M K Q Y F K T
12901 CTGTTAGCCAAAACTATTACCCCCTATCACAAAGGAAAAATGAAACAGTACTTCAAAACC

4321 F L L T I A V I I F F L L F - K N E M P
12961 TTTTTACTAACCATTGCCGTAATTATCTTCTTCCTTCTGTTCTAAAAGAACGAAATGCCC

4341 L A D G H E - A P - L R I I Q L A G L I
13021 CTCGCCGATGGCCACGAATGAGCCCCGTGATTACGAATAATACAATTAGCAGGGCTCATC

4361 H T P Q Q I L T H Y N T S H - P L M T H
13081 CACACACCACAACAAATACTCACCCATTACAATACATCTCACTGACCCCTAATGACTCAC

4381 R P Q P H S K A L P H - S T S P L T N T
13141 CGACCACAACCTCACTCCAAGGCTCTCCCACACTAATCCACATCCCCCCTCACAAATACC

4401 P T H N R S R S T T P L N K E T Q P P W
13201 CCCACGCACAACAGATCCCGATCAACAACCCCACTCAATAAAGAAACACAGCCCCCTTGG

4421 I P P P L K T L - K D H Q - T P H K K Q
13261 ATACCCCCACCCCTCAAAACCCTATAAAAGGATCATCAGTGAACCCCACACAAAAAGCAA

4441 I P P V S P P D K L I I P P G A - N F H
13321 ATACCACCAGTAAGCCCCCCAGATAAATTAATAATACCACCAGGGGCATAAAACTTCCAC

4461 P Q L L P N H Y R T Q P Q K A S S L Q Q
13381 CCTCAACTACTACCAAACCACTACCGAACACAGCCACAAAAAGCAAGCTCACTACAGCAA

4481 S G S L N L P L P L S H I L V - N N K K
13441 AGTGGATCATTGAACTTGCCGCTACCATTATCGCACATACTAGTATAAAACAACAAAAAA

4501 T T - S P S F L F G F Q P K P E A - K A
13501 ACAACGTAATCTCCATCATTTTTATTTGGATTTCAACCAAAACCTGAGGCCTGAAAAGCC

4521 P V V L Q L - K P M T H Q L R K S H P L
13561 CCCGTTGTCCTTCAACTATAAAAACCCATGACCCACCAGCTACGAAAATCCCACCCACTT

4541 I K L I N Q T L I D L P T P S N I S A C
13621 ATTAAACTTATTAACCAAACCCTTATTGACCTCCCAACACCCTCAAACATCTCAGCTTGT

4561 - N F G S L L G L T L L I Q I L T G V F
13681 TGAAACTTTGGATCACTACTAGGCCTAACCCTTCTAATCCAGATCCTAACAGGAGTCTTC

4581 L I M H F S S G D T I A F S S V A Y T S
13741 TTAATAATGCACTTCTCATCGGGTGACACCATAGCATTTTCATCTGTCGCCTACACCTCC

4601 R E V W F G W L I R G L H I N G A S L F
13801 CGTGAAGTTTGGTTCGGGTGGCTTATTCGCGGCCTCCACATAAACGGGGCCTCTCTCTTC

4621 F I F I F L H I G R G L Y Y A S Y L H E
13861 TTCATATTCATCTTCCTCCACATCGGACGAGGCCTATACTACGCATCCTACCTTCACGAG

4641 S T - N V G V I I L L L L I A T A F I G
13921 AGCACGTGAAATGTCGGAGTAATTATACTCCTACTCCTGATAGCCACTGCATTCATAGGC

4661 Y V L P - G Q I S F W G A T V I T N L L
13981 TACGTCCTCCCGTGAGGACAAATATCGTTCTGGGGAGCAACCGTAATTACAAATCTACTA

4681 S A T P Y V G S T V V P - I - G G P S V
14041 TCCGCCACACCCTACGTTGGAAGCACTGTTGTACCCTGAATCTGAGGCGGCCCCTCTGTA

4701 D N A T L I R F T A L H F I L P F A L L
14101 GACAACGCAACACTCATACGCTTCACCGCCCTACACTTCATTCTCCCTTTTGCCCTATTA

4721 A S L V T H L I F L H E R G S F N P L G
14161 GCCTCACTAGTTACCCACCTAATCTTCCTACACGAACGAGGATCCTTCAACCCCCTAGGA

4741 V N S N T D K I P F H P Y Y T L K D T L
14221 GTCAACTCGAATACTGACAAAATCCCATTCCACCCCTACTATACCCTAAAAGACACCCTT

4761 G A A L A A S A L L T L A L Y L P T L L
14281 GGAGCAGCACTAGCCGCCTCAGCACTACTCACCCTCGCCCTCTATTTACCAACCTTATTA

4781 S D P E N F T Q A N S I I T P T H I K P
14341 AGCGACCCTGAAAACTTTACCCAAGCAAACTCCATAATTACCCCCACACACATTAAACCA

4801 E W Y F L F A Y A I L R S T P N K L G G
14401 GAATGGTACTTCTTATTCGCCTACGCTATTCTACGATCCACCCCTAACAAACTAGGAGGA

4821 V L A M F S S I L I L L L M P F L H T T
14461 GTACTAGCCATGTTTTCATCTATTCTAATCCTACTTCTAATGCCCTTCTTACACACAACT

4841 K Q Q P I S T R P M S Q L L F W A L V L
14521 AAACAGCAACCGATATCAACACGCCCCATGTCTCAGCTCCTATTCTGGGCCCTCGTCCTA

4861 D F F V L T - I G G Q P V N S T Y I L M
14581 GACTTCTTCGTACTCACATGAATCGGAGGTCAACCAGTAAACTCCACATACATCTTAATG

4881 G Q T A S V L Y F A I I L I L I P T I G
14641 GGCCAAACCGCCTCCGTGCTCTACTTCGCCATCATCCTCATCCTCATACCCACAATCGGA

4901 L L E N K I T S F I Y T I S P R I T P I
14701 CTCCTGGAAAACAAAATAACTAGCTTCATCTACACCATCAGCCCCCGAATCACCCCCATA

4921 K F S P H P S R P T A L L Q Q R K T P P
14761 AAATTTAGCCCCCATCCTAGTCGCCCCACCGCACTTCTCCAACAAAGAAAAACTCCACCA

4941 L S - L K R K A L A L - D R S G R Q T P
14821 CTCTCGTAGCTAAAAAGAAAAGCGCTGGCCTTGTAAGACAGAAGTGGACGACAAACACCC

4961 S R E Y T H L S Q G G K - N F T L R P P
14881 TCCCGAGAGTACACCCACTTAAGTCAAGGAGGCAAATAAAACTTTACACTTCGGCCCCCA

4981 K P K F - L N Y S L P H I Y V V V A - I
14941 AAGCCGAAATTCTAATTAAACTACTCCTTGCCACACATCTACGTTGTCGTAGCTTAAATA

5001 L K H N T E N V N M D S Q S R I T H P G
15001 CTAAAGCATAACACTGAAAATGTTAATATGGACAGCCAGTCCCGAATAACGCACCCCGGC

5021 Q P Q A P C H Q P I F S S L P P Y V Y R
15061 CAACCACAGGCGCCATGTCATCAACCCATATTTAGCTCACTTCCTCCCTATGTATATCGC

5041 A F I Y L P H T H I P P L R L V H C T G
15121 GCATTCATCTATTTGCCCCATACACACATCCCCCCACTCAGATTGGTCCACTGTACAGGG

5061 V L A I R V I F R S V L T I T S F K L I
15181 GTTCTCGCTATCCGCGTCATCTTTCGTTCAGTACTAACTATTACTAGCTTCAAGCTCATA

5081 P G H G F H V L L F K R P L V I T L T S
15241 CCTGGACACGGCTTCCATGTATTGCTTTTTAAGAGGCCTCTGGTTATCACTCTCACGTCC

5101 I S C D C L D I R P S S - R P Q P A P S
15301 ATATCTTGCGATTGCCTGGACATTCGTCCCTCTTCTTAGAGGCCTCAACCCGCACCGTCT

5121 W S P L I F V R D R G I S S L S T F S G
15361 TGGTCTCCACTCATTTTTGTCCGTGATCGCGGCATCTCCAGCTTGAGCACATTTAGTGGA

5141 F L F F G G E F R F H L G D Y F F K F P
15421 TTTTTATTTTTTGGGGGAGAGTTCAGGTTCCACTTGGGCGACTATTTCTTTAAATTCCCG

5161 V S K K T L - T Y K T I I L S P R S H A
15481 GTCAGTAAGAAAACACTCTAGACTTATAAAACTATAATACTTTCGCCCCGCTCTCACGCG

5181 H T L N A L L Y I P P P P P M Y L R R L
15541 CATACTCTAAATGCTCTATTGTACATCCCCCCCCCCCCCCCCATGTATCTGCGGCGGTTG

5201 G F R C T Y S C T I I G P - I Y I I G P
15601 GGGTTCAGGTGCACATATAGCTGCACCATTATAGGGCCATAAATTTATATTATAGGGCCA

5221 - I Y I I G P - I Y I Y R A I N L Y Y R
15661 TAAATTTATATTATAGGGCCATAAATTTACATTTATAGAGCCATAAATTTATATTATAGG

5241 A I N L Y Y R V I N L H L - G H K F T F
15721 GCCATAAATTTATATTATAGAGTCATAAATTTACATTTATAGGGCCATAAATTTACATTT

5261 I E P - I Y I I G P - I Y I Y R A I N L
15781 ATAGAGCCATAAATTTATATTATAGGGCCATAAATTTACATTTATAGAGCCATAAATTTA

5281 Y Y R A I N L S Y R A I N L H L - G H K
15841 TATTATAGGGCCATAAATTTATCTTATAGGGCCATAAATTTACATTTATAGGGCCATAAA

5301 F T F I R A I N L Y Y R T I N L Y Y R T
15901 TTTACATTTATAAGAGCCATAAACCTATATTATAGAACCATAAACTTATATTATAGAACC

5321 I N L Y Y R T I N L H T T P - T R I T N
15961 ATAAACTTATATTATAGAACCATCAATTTACACACCACACCATAAACCCGAATCACAAAC

5341 T K Q K S T I Q L K H H I V I T P R T N
16021 ACCAAACAAAAATCAACCATCCAACTAAAACACCACATCGTTATTACCCCGAGAACTAAC

5361 Q N S N
16081 CAAAACTCTAATAA

I don't know if this helps or not, but...

Last edited by Ibeechu on Thu Aug 09, 2007 6:42 pm, edited 1 time in total.

Made even smaller for great justice



Thu Aug 09, 2007 6:32 pm
Profile
Moderator [Designated]
User avatar

Joined: Thu Jun 14, 2007 4:54 pm
Posts: 455
Location: Essex, UK
Unread post Re: sample1000101.txt
Mother of GOD could that post be any longer lol


Thu Aug 09, 2007 6:33 pm
Profile WWW
Data [Authenticated]

Joined: Fri Jun 22, 2007 6:28 pm
Posts: 192
Location: Ontario, Canada
Unread post Re: sample1000101.txt
I got the Jonas bot to say "I am a Professor of Genetics" maybe I just didn't read carefully enough before, but I sort of assumed he was an anthropologist or something. Could it be that Jonas has left these messages for us? I know that we've been assuming these are from the past, but it seems odd that strings of DNA show up at the same time as our geneticist.


Thu Aug 09, 2007 6:35 pm
Profile
Facilitator [Conditional]

Joined: Thu Jun 14, 2007 5:30 pm
Posts: 508
Unread post Re: sample1000101.txt
thats the floods dna make up - we know each and every protein that makes them up now lol


Thu Aug 09, 2007 6:38 pm
Profile
Data [Authenticated]

Joined: Mon Jun 25, 2007 12:59 pm
Posts: 221
Location: KW, Ontario
Unread post Re: sample1000101.txt
regarding the binary:

there are 35 digits, or 5 sets of 7, often used for ascii. The only readable (note, not legible) translation with no leftover binary is that grouping.

to ascii, 0111101 0100010 1010010 1101101 0110101 becomes ="Rm5
or in decimal, "61 34 82 109 53"


the other numbers at the top:
Code:
<planet---#> 0001000
<category-#> 1011010
<index----#> 1110101
<sample---#> 1000101

(also 7 digits) are
Code:
BKSP (8)
Z (90)
u (117)
E (69)

* Planet:8 - the 8th planet is neptune (unless the number is 0-based, in which case it's 9, or Pluto - which might mean it's a reference to our solar system with 9 planets (though outdated:P))
* Category:Z - not sure
* Index:117 - common number :cool:
* Sample:E - Earth?


Thu Aug 09, 2007 8:07 pm
Profile WWW
Data [Authenticated]

Joined: Thu Aug 09, 2007 7:30 pm
Posts: 100
Location: Canmore, Alberta, Canada
Unread post Re: sample1000101.txt
Not the flood... but rather a Flood-infected creature of non-human origin.


Thu Aug 09, 2007 8:13 pm
Profile
Data [Undefined]

Joined: Thu Aug 09, 2007 6:20 pm
Posts: 3
Unread post Re: sample1000101.txt
Following on from Ibeechu's observation, I did a quick compairison between the original genome sequence and the one presented in sample1000101.txt. There are a few more differences. I've attached an image showing those.

So far I can't find anything else that matches the text file quite as well as the link I have already posted. I don't know if the genome between different species are minor differences or major ones.

If you are looking for some kind of hidden message, I'd think it would be in the binary or encoded in the differences between genomes.

On another note, the text "additional CM analysis unnecessary" may be refering to this http://en.wikipedia.org/wiki/Centimorgan. Anyone with a Biology background able to shed some light on this?

Another shot in the dark, the file refers to <category-#> 1011010.
1011010 in decimal is 90, a quick search for Category 90 shows that Nasa use that as a classification for Astrophysics.
http://www.sti.nasa.gov/sscg/90.html


-- APF


Attachments:
COMPARE.PNG
COMPARE.PNG [ 39.4 KiB | Viewed 6963 times ]
Thu Aug 09, 2007 8:48 pm
Profile
Display posts from previous:  Sort by  
Reply to topic   [ 74 posts ]  Go to page 1, 2, 3, 4, 5 ... 8  Next

Who is online

Users browsing this forum: Bing [Bot] and 1 guest


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
cron
Powered by phpBB © 2000, 2002, 2005, 2007 phpBB Group.
Designed by STSoftware for PTF.